On this page:

Alternate
pGP704 based
vectors.


salmonella.org

Salmonella
Genome
Sequencing

Salmonella
Genetics Tips
and Tricks

Search
Salmonella
Collections

Salmonella
information

Related Links

Salmonella
Researchers

About this Site

Vector
information


pGP704 map
Suicide Vector Sequence Assemblies.

We have constructed four improved vectors for allelic exchange. The advantage of these vectors is that they contain sacB, the levansucrase from B. subtilis for counter selection, and a wider range of antibiotic resistance markers for selecti on. Check this reference for full details.


The pGP704 sequence used as the basis for this was taken from the web-published sequence available here.

sacB

There is currently a problem with the sacB sequence that I cannot resolve unless the junctions of the gene are sequenced. For some reason there are 700bp of unaccounted DNA between the original sacB reference and the modified sacB allele. Until I have sequenced the junction I do not know where this DNA comes from. It appears from the references that it is probably pBR322 DNA, but it does not contain any common restriction enzyme sites.

The sacB sequence was taken from accession number X02730. This sequence was modified as described by McIver et al. to remove three restriction sites by site directed mutagenesis using the primers shown below:

EcoRI: AAGTTCCTGAGTTCATTCG
KpnI: GCAAATGGTATCTGTTCACT
HindIII: CGTTTGCGCCCAGCTTCCTG
The italicized sites indicate where the mutations were introduced to knockout the restriction sites

The sacB gene was cloned on an EcoRI fragment into the EcoRI site in pGP704. Until I have more information about the sequence I cannot be sure of these junctions.

pRE107

The BamHI site in oriV was blunted to GGATCGATCC.

pRE112

pRE107 was cut with BamHI and the overhanging ends polished with Klenow. The AmpR cassette was replaced with a CamR cassette constructed by PCR from pACYC184 (accesion number X06403) using primers CATGGTACCCGGGCCCTAAATACCTGTGACGGAAGAT and AACTGCAGACCCGGGCCCTATCACTTATTCAGGCGTAGC. This PCR product was cut with SmaI and ligated into blunted BamHI sites in pRE107.

pDMS197

pRE107 was cut with BamHI and the overhanging ends polished with Klenow. The AmpR cassette was replaced with a TetR cassette constructed from pBR322 (accession number J01749). pBR322 was cut with EcoRI and StyI and the ends polished and the approximately 1kb fragment was ligated into blunted BamHI sites in pRE107.

pRE118

pUC71-K was cut with BamHI and the 1kb fragment ligated into BamHI cut pRE107. For the sequence assembly the kan sequence was taken from pUC4K, the parent of pUC71-K (accession number X06404. The BamHI fragment containing the Kan cassette is the same in this plasmid as in pUC71-K.

The sequences

At the moment only raw text files are available, but these will be annotated when I get more time

August 11th, 1998pRE107 has been updated to incorporate the GGAAG to CAG correction noted by sequencing the overlap. This change does not affect pRE112, pRE118 or pDMS197 as they donot contain this stratch of DNA.

pRE107

pRE112

pRE118

pDMS197

To save these files to your computer either follow the link and then choose Save As from the File menu or Mac: click and hold, Windows: right click on the link, then choose "Save Link As"

If you have any problems email me.

Rob Edwards, 11th August 1998